Search result for sequence:
TACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGAGAGGCAAGTCTGATGTGAAAACCCGGGGCTCAACCCCGGGACTGCATTGGAAACTGTTTTTCTAGAGTGTCGGAGAGGTAAGTGGAATTCCTAG
common ontology terms
term enrichment score
TermScore
feces0.307453
canis lupus familiaris0.307076
dog0.289042
homo sapiens0.216300
united states of america0.171279
adult0.167211
italy0.166205
rectum0.124031
infant0.105680
china0.101654
colon0.093489
child0.091008
sweden0.088328
ovis aries0.087591
kingdom of spain0.076503
wild0.074534
age 30-500.067227
control0.065484
zoological garden0.062500
high bmi0.061381
sheep0.060150
age 2-4 years0.051064
cat0.050000
state of north carolina0.049793
formula fed0.049180
felis catus0.049180
gay0.048000
state of new york0.048000
guangzhou city prefecture0.046875
age 1 year0.046875
heterosexual0.046875
msw0.046875
obsolete_juvenile stage0.046875
female0.046584
captive0.046154
homosexual0.045802
msm0.045802
obesity0.045802
age0.044776
hiv infection0.041958
caecum0.036254
lama guanicoe0.034188
midwest region0.034188
acinonyx jubatus0.034188
age 1-3 years0.034188
pemba island0.034188
nephrolithiasis0.034188
nanning city prefecture0.034188
age 50-60 years0.034188
state of louisiana0.034188
indonesia0.034188
municipality of yogyakarta0.034188
age 3-60.034188
LOWER IN exocrine pancreatic insufficiency0.034188
perianal skin0.034188
urocyon littoralis0.034188
urocyon littoralis catalinae0.034188
santa catalina island fox0.034188
dairy0.034188
lake hulun0.034188
LOWER IN age 30-500.034188
LOWER IN age 60-790.034188
age >940.034188
male0.033994
namibia0.033613
estonia0.033613
santa catalina island0.033613
age 30 days0.033613
LOWER IN rural community0.033613
LOWER IN metronidazole0.033333
body mass index0.033333
systemic lupus erythematosus0.033058
tanzania0.033058
russia0.033058
new zealand0.033058
lamb0.033058
germany0.032967
LOWER IN low bmi0.032787
LOWER IN duodenum0.032520
rectal swab0.032520
mongolia0.032520
age 6 weeks0.032520
LOWER IN antibiotic0.031746
LOWER IN ileum0.031746
south africa0.031496
zhejiang province0.031496
state of minnesota0.031496
new york city0.031496
city0.030303
rattus norvegicus0.030075
french republic0.029630
diet0.029197
LOWER IN control0.028470
rat0.027586
winter0.027211
farm0.027027
research facility0.018490
chronic fatigue syndrome0.017391
new york county0.017391
enzyme supplement0.017391
Fraction of dbbact annotations with this term covered by the query
TermScore
age 2-4 years0.666667
age 30-500.666667
dog0.650000
canis lupus familiaris0.625000
chronic fatigue syndrome0.500000
new york county0.500000
lama guanicoe0.500000
enzyme supplement0.500000
LOWER IN no enzyme supplement0.500000
exocrine pancreatic insufficiency0.500000
flagstaff0.500000
age 7 months0.500000
age 25-50 years0.500000
midwest region0.500000
acinonyx jubatus0.500000
panthera tigris0.500000
tiger0.500000
age 1-3 years0.500000
pemba island0.500000
nephrolithiasis0.500000
nanning city prefecture0.500000
age 50-60 years0.500000
state of louisiana0.500000
domestic0.500000
LOWER IN cron diet0.500000
sesame allergy0.500000
LOWER IN milk allergy0.500000
age 4-10 years0.500000
santa catarina state0.500000
indonesia0.500000
municipality of yogyakarta0.500000
age 3-60.500000
LOWER IN age 8-120.500000
LOWER IN age 13-140.500000
rectum0.500000
LOWER IN enzyme supplementation0.500000
LOWER IN exocrine pancreatic insufficiency0.500000
novosibirsk0.500000
city of melbourne0.500000
LOWER IN egypt0.500000
perianal skin0.500000
urocyon littoralis0.500000
urocyon littoralis catalinae0.500000
santa catalina island fox0.500000
felis silvestris0.500000
wild cat0.500000
dairy0.500000
LOWER IN commonwealth of massachusetts0.500000
LOWER IN city of boston0.500000
gymnogyps californianus0.500000
california condor0.500000
age 2-7 years0.500000
LOWER IN age 8 weeks0.500000
LOWER IN puppy0.500000
LOWER IN age 7 months0.500000
aardvark0.500000
orycteropus afer0.500000
dog breeding center0.500000
beagle dog0.500000
puppy0.500000
hmong0.500000
LOWER IN myanmar0.500000
LOWER IN karen0.500000
LOWER IN estonia0.500000
lake hulun0.500000
vulpes corsac0.500000
corsac fox0.500000
canis mesomelas0.500000
LOWER IN wildlife sactuary0.500000
LOWER IN plant diet0.500000
vulpes vulpes0.500000
red fox0.500000
LOWER IN peru0.500000
LOWER IN tunapuco0.500000
suckling0.500000
preweaned0.500000
age 2-4 weeks0.500000
age 8-120.500000
LOWER IN age 30-500.500000
LOWER IN age 60-790.500000
LOWER IN age 0-6 months0.500000
LOWER IN external acoustic meatus0.500000
LOWER IN ear canal0.500000
LOWER IN venezuela0.500000
LOWER IN amerindian0.500000
LOWER IN hunter gatherer0.500000
children0.500000
age >940.500000
vicugna pacos0.500000
alpaca0.500000
age one year0.500000
LOWER IN age one month0.500000
age 60-790.500000
LOWER IN age 19-240.500000
LOWER IN soldiers0.500000
ovis aries musimon0.500000
mouflon0.500000
toronto zoo0.500000
panax notoginseng0.500000
xundian county0.500000
Fraction of annotations for the query sequences containing the term
TermScore
feces0.876106
homo sapiens0.495575
united states of america0.353982
adult0.274336
canis lupus familiaris0.203540
dog0.185841
china0.168142
italy0.132743
control0.106195
infant0.070796
rectum0.070796
child0.061947
kingdom of spain0.061947
sweden0.061947
colon0.061947
ovis aries0.053097
male0.053097
wild0.053097
female0.044248
sheep0.035398
LOWER IN control0.035398
age 30-500.035398
high bmi0.035398
zoological garden0.035398
age 2-4 years0.026549
state of north carolina0.026549
guangzhou city prefecture0.026549
germany0.026549
age 1 year0.026549
formula fed0.026549
heterosexual0.026549
msw0.026549
felis catus0.026549
cat0.026549
hiv infection0.026549
gay0.026549
homosexual0.026549
msm0.026549
obesity0.026549
obsolete_juvenile stage0.026549
caecum0.026549
state of new york0.026549
captive0.026549
research facility0.026549
age0.026549
lama guanicoe0.017699
systemic lupus erythematosus0.017699
midwest region0.017699
acinonyx jubatus0.017699
south africa0.017699
zhejiang province0.017699
tanzania0.017699
age 1-3 years0.017699
pemba island0.017699
nephrolithiasis0.017699
nanning city prefecture0.017699
age 50-60 years0.017699
namibia0.017699
LOWER IN antibiotic0.017699
LOWER IN metronidazole0.017699
state of louisiana0.017699
state of minnesota0.017699
diet0.017699
indonesia0.017699
municipality of yogyakarta0.017699
age 3-60.017699
body mass index0.017699
LOWER IN low bmi0.017699
estonia0.017699
LOWER IN duodenum0.017699
LOWER IN ileum0.017699
LOWER IN exocrine pancreatic insufficiency0.017699
russia0.017699
perianal skin0.017699
santa catalina island0.017699
urocyon littoralis0.017699
urocyon littoralis catalinae0.017699
santa catalina island fox0.017699
dairy0.017699
age 30 days0.017699
rattus norvegicus0.017699
new york city0.017699
rat0.017699
french republic0.017699
rectal swab0.017699
farm0.017699
mongolia0.017699
winter0.017699
lake hulun0.017699
city0.017699
LOWER IN rural community0.017699
LOWER IN age 30-500.017699
LOWER IN age 60-790.017699
age >940.017699
new zealand0.017699
lamb0.017699
age 6 weeks0.017699
LOWER IN autistic disorder0.008850
chronic fatigue syndrome0.008850
new york county0.008850
Exp. ID User ID Description Date Region Flag Sequences
666amnondominant feces, ovis aries, italy, sheep2020-09-25v3No1 / 7
564amnon high in control compared to autistic disorder in feces homo sapiens child italy age 2-4 years 2019-11-18v3No1 / 14
702amnoncommon feces, united states of america, canis lupus familiaris, state of north carolina, dog2028-04-02v4No1 / 15
12amnon high in chronic fatigue syndrome compared to control in feces homo sapiens new york county 2016-11-02v4No1 / 18
666amnondominant feces, italy, lama guanicoe2020-09-25v3No1 / 18
707amnondominant feces, homo sapiens, female, adult, guangzhou city prefecture, age 30-50, systemic lupus erythematosus, china2028-04-11v3No1 / 22
601amnon high in type 2 diabetes mellitus compared to control in feces homo sapiens adult china 2020-03-30v4No1 / 24
797amnondominant feces, homo sapiens, infant, germany, age 1 year, formula fed2021-06-13v3No1 / 25
578amnondominant feces, homo sapiens, control, adult, kingdom of spain, sweden, heterosexual, msw, male2020-01-14v3No1 / 26
150amnonhigh in EPI dogs with enzyme supplement compared to no supplement ( high in enzyme supplement compared to no enzyme supplement in feces united states of america canis lupus familiaris dog exocrine pancreatic insufficiency )2017-04-26v4No1 / 27
540amnoncommon feces, united states of america, canis lupus familiaris, state of arizona, flagstaff, dog2019-07-31v4No1 / 28
573amnoncommon feces, united states of america, juvenile stage, canis lupus familiaris, commonwealth of pennsylvania, dog2019-12-22v4No1 / 30
797amnon high in formula fed compared to breast fed in feces homo sapiens infant germany age 7 months 2021-06-13v3No1 / 31
745amnon high in age 25-50 years compared to age 50-80 years in feces homo sapiens united states of america adult midwest region 2021-02-25v3No1 / 32
706amnoncommon feces, united states of america, canis lupus familiaris, state of north carolina, dog2028-04-10v4No1 / 37
406amnoncommon feces, acinonyx jubatus, south africa, cheetah2018-11-21v4No1 / 43
666amnoncommon feces, italy, panthera tigris, tiger2020-09-25v3No1 / 43
597amnoncommon feces, homo sapiens, control, adult, zhejiang province, china2020-03-23v3No1 / 46
597amnoncommon feces, homo sapiens, adult, zhejiang province, gout, china2020-03-23v3No1 / 47
736amnoncommon feces, homo sapiens, child, tanzania, age 1-3 years, pemba island2021-01-25v3No1 / 49
564amnoncommon feces, homo sapiens, control, child, italy, age 2-4 years2019-11-18v3No1 / 50
702amnoncommon feces, united states of america, felis catus, state of north carolina, cat2028-04-02v4No1 / 51
578amnoncommon feces, homo sapiens, hiv infection, adult, kingdom of spain, sweden, heterosexual, msw, male2020-01-14v3No1 / 53
286amnonhigher in feces of individuals with kidney stones ( high in nephrolithiasis compared to control in feces homo sapiens adult nanning city prefecture age 50-60 years china )2018-01-27v4No1 / 54
15amnoncommon feces, acinonyx jubatus, namibia2016-11-08v4No1 / 55
707amnoncommon feces, homo sapiens, female, adult, guangzhou city prefecture, age 30-50, systemic lupus erythematosus, china2028-04-11v3No1 / 55
745amnoncommon feces, homo sapiens, united states of america, adult, midwest region2021-02-25v3No1 / 55
648amnon high in control compared to antibiotic metronidazole in feces united states of america canis lupus familiaris dog state of louisiana 2020-09-06v4No1 / 56
759amnoncommon feces, united states of america, canis lupus familiaris, state of minnesota, dog, domestic2021-04-04v4No1 / 57
293amnonlower in caloric restriction (CRON) diet compared to american diet ( high in diet american diet compared to cron diet caloric restriction diet in feces homo sapiens united states of america adult )2018-02-07v4No1 / 61
695amnon high in sesame allergy compared to milk allergy in feces homo sapiens child israel food allergy age 4-10 years 2028-03-27v4No1 / 64
757amnoncommon feces, homo sapiens, adult, brazil, santa catarina state2021-03-28v3No1 / 67
72amnoncommon feces, united states of america, canis lupus familiaris, iowa2017-02-25v4No1 / 69
723amnoncommon feces, homo sapiens, female, adult, indonesia, municipality of yogyakarta2021-01-02v3No1 / 69
578amnoncommon feces, homo sapiens, hiv infection, adult, kingdom of spain, sweden, gay, homosexual, msm, male2020-01-14v3No1 / 74
438amnonhigher in kindergarten compared to primary and middle school kids ( high in age 3-6 compared to age 8-12 age 13-14 in feces homo sapiens china )2018-12-30v4No1 / 76
122amnonpositively correlated with bmi ( high in body mass index high bmi compared to low bmi in feces homo sapiens united kingdom )2017-04-13v4No1 / 77
799amnoncommon in obese participant fecal samples before ketogenic diet (common feces, homo sapiens, obesity, adult, estonia, high bmi)2021-06-13v3No1 / 77
630amnoncommon feces, homo sapiens, adult, kingdom of spain, madrid2020-06-01v3No1 / 78
301amnon high in rectum colon compared to duodenum ileum in united states of america canis lupus familiaris dog 2018-03-05v4No1 / 79
399amnoncommon feces, united states of america, state of tennessee, zoological garden, panthera leo, lion2018-11-16v4No1 / 79
707amnoncommon feces, homo sapiens, female, adult, guangzhou city prefecture, age 30-50, china2028-04-11v3No1 / 82
648amnoncommon feces, united states of america, canis lupus familiaris, dog, state of louisiana2020-09-06v4No1 / 83
231amnoncommon in dog rectum (common feces, united states of america, rectum, canis lupus familiaris, dog)2017-11-02v4No1 / 84
150amnonhigh in healthy dogs compared to EPI dogs recieving enzyme supplementation ( high in control compared to enzyme supplementation exocrine pancreatic insufficiency in feces united states of america canis lupus familiaris dog )2017-04-26v4No1 / 85
680amnoncommon feces, homo sapiens, obesity, adult, russia, novosibirsk2028-03-04v3No1 / 85
340amnoncommon feces, felis catus, australia, city of melbourne, cat2018-05-27v4No1 / 87
62amnon high in united states of america compared to egypt in feces homo sapiens child obsolete_juvenile stage 2017-02-13v4No1 / 88
582amnoncommon united states of america, rectum, wild, perianal skin, santa catalina island, urocyon littoralis, urocyon littoralis catalinae, santa catalina island fox2020-01-22v4No1 / 88
666amnoncommon feces, italy, felis silvestris, wild cat2020-09-25v3No1 / 91
578amnoncommon feces, homo sapiens, control, adult, kingdom of spain, sweden, heterosexual, msw, male2020-01-14v3No1 / 92
799amnoncommon in obese participant fecal samples after 1 month ketogenic diet (common feces, homo sapiens, obesity, adult, estonia, high bmi, ketogenic diet)2021-06-13v3No1 / 93
363amnoncommon dairy, rectum, caecum, colon, ovis aries, italy, obsolete_juvenile stage, age 30 days2018-08-29v4No1 / 94
488amnoncommon feces, control, canis lupus familiaris, italy, dog2019-02-25v4No1 / 94
759amnoncommon feces, united states of america, rattus norvegicus, state of new york, new york city, rat, wild2021-04-06v4No1 / 94
736amnoncommon feces, homo sapiens, female, adult, tanzania, pemba island2021-01-25v3No1 / 95
759amnon high in state of new york new york city wild compared to research facility commonwealth of massachusetts city of boston in feces united states of america rattus norvegicus rat 2021-04-06v4No1 / 96
753amnoncommon feces, zoological garden, adult, captive, canis lupus, china, wolf2021-03-12v4No1 / 98
645amnoncommon cloaca, state of idaho, bird, captive, gymnogyps californianus, california condor2020-09-03v4No1 / 99
363amnon high in rectum caecum colon compared to ruminant reticulum omasum rumen in dairy ovis aries italy obsolete_juvenile stage age 30 days 2018-08-29v4No1 / 101
766amnon high in female organism adult organism age 2-7 years compared to age 8 weeks puppy in feces canis lupus familiaris french republic dog rectal swab 2021-04-12v4No1 / 101
301amnoncommon united states of america, colon, canis lupus familiaris, dog2018-03-05v4No1 / 105
797amnon high in age 1 year compared to age 7 months in feces homo sapiens infant germany formula fed 2021-06-13v3No1 / 106
406amnoncommon feces, zoological garden, south africa, aardvark, orycteropus afer2018-11-21v4No1 / 107
399amnoncommon feces, united states of america, canis lupus familiaris, dog2018-11-16v4No1 / 108
436amnoncommon feces, united states of america, felis catus, state of colorado, cat2018-12-25v4No1 / 108
301amnoncommon united states of america, rectum, canis lupus familiaris, dog2018-03-05v4No1 / 116
753amnoncommon feces, farm, adult, canis lupus familiaris, dog, china, dog breeding center2021-03-12v4No1 / 120
69amnoncommon feces, united states of america, research facility, canis lupus familiaris, beagle dog2017-02-21v4No1 / 125
150amnonhigh in healthy dogs compared to EPI dogs without treatment ( high in control compared to exocrine pancreatic insufficiency in feces united states of america canis lupus familiaris dog )2017-04-26v4No1 / 126
578amnoncommon feces, homo sapiens, control, adult, kingdom of spain, sweden, gay, homosexual, msm, male2020-01-14v3No1 / 132
766amnon high in age 8 weeks compared to age 2 days in feces canis lupus familiaris french republic dog rectal swab puppy 2021-04-12v4No1 / 133
400amnonhigher in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in hmong china compared to myanmar karen in feces homo sapiens thailand rural community )2018-11-18v4No1 / 135
63amnonpositively correlated with bmi ( high in body mass index high bmi compared to low bmi in feces homo sapiens united states of america )2017-04-11v4No1 / 139
132amnoncommon feces, homo sapiens, united states of america2017-04-16v4No1 / 145
241amnonhigher in babies from russia compared to estonia ( high in russia compared to estonia in feces homo sapiens infant age < 3 years )2017-11-13v4No1 / 146
815amnoncommon feces, mongolia, winter, wild, lake hulun, vulpes corsac, corsac fox2021-07-04v3No1 / 146
15amnoncommon feces, namibia, canis mesomelas2016-11-08v4No1 / 147
759amnon high in canis lupus familiaris dog compared to canis lupus wolf wildlife sactuary in feces united states of america state of minnesota 2021-04-06v4No1 / 148
74amnonHigher in animal product diet compared to plant diet ( high in diet animal product diet compared to plant diet in feces homo sapiens united states of america )2017-02-27v4No1 / 149
815amnoncommon feces, mongolia, winter, wild, vulpes vulpes, lake hulun, red fox2021-07-04v3No1 / 160
276amnon high in united states of america city state of oklahoma compared to peru small village tunapuco rural community in feces homo sapiens adult 2018-01-22v4No1 / 168
521amnoncommon in pre-weaned pigs (common feces, farm, sus scrofa, jiangxi province, pig, suckling, preweaned, age 2-4 weeks, china)2019-07-02v3No1 / 169
241amnonlower in babies age <1 year compared to age 1-3 years ( high in age age 1-3 years compared to age < 1 year in feces homo sapiens infant )2017-11-13v4No1 / 173
150amnoncommon feces, united states of america, canis lupus familiaris, dog2017-04-26v4No1 / 208
669amnon high in age 1 year compared to age 2 months in feces homo sapiens infant sweden 2020-09-26v4No1 / 212
566amnoncommon feces, homo sapiens, adult, china2019-11-24v4No1 / 221
286amnoncommon in feces of individuals with kidney stones (common feces, homo sapiens, adult, nanning city prefecture, age 50-60 years, nephrolithiasis, china)2018-01-27v4No1 / 239
438amnon high in child age 3-6 age 8-12 compared to adult age 30-50 age 60-79 in feces homo sapiens china 2018-12-30v4No1 / 279
683amnonlower in antibiotic treatment (combined 3 antibiotics) compared to pre-treatment ( high in control compared to antibiotic vancomycin metronidazole neomycin in feces homo sapiens united states of america adult state of california )2028-03-04v4No1 / 301
723amnon high in age 2-4 years compared to infant age 0-6 months in feces homo sapiens child indonesia municipality of yogyakarta 2021-01-02v3No1 / 305
208amnoncommon feces, united states of america, mus musculus, balb/c, state of texas, mouse2017-10-06v4No1 / 316
299amnon high in mouth neoplasm cancer compared to control in homo sapiens saliva adult china 2018-02-27v4No1 / 319
400amnonlower in people from thailand compared to 2nd generation immigrants to usa ( high in united states of america compared to thailand rural community in feces homo sapiens )2018-11-18v4No1 / 343
582amnon high in rectum perianal skin compared to external acoustic meatus ear canal in united states of america wild santa catalina island urocyon littoralis urocyon littoralis catalinae santa catalina island fox 2020-01-22v4No1 / 400
371amnonlower in amerindians compared to western visitors ( high in united states of america city compared to venezuela amerindian hunter gatherer in feces homo sapiens )2018-09-06v4No1 / 417
666amnoncommon feces, italy, lama guanicoe2020-09-25v3No1 / 437
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in homo sapiens united states of america rectum caecum colon sigmoid colon terminal ileum biopsy children )2016-11-14v4No1 / 459
438amnonhigher in centenarians compared to adults ( high in age >94 compared to age 30-50 age 60-79 in feces homo sapiens china )2018-12-30v4No1 / 474
650amnon high in caucasian european compared to asian in feces homo sapiens united states of america adult state of new york 2020-09-12v4No1 / 475
666amnoncommon feces, bos taurus, italy, cow2020-09-25v3No1 / 482
578amnonhigher in gay (msm) individuals compared to heterosexual (msw) ( high in gay homosexual msm compared to heterosexual msw in feces homo sapiens hiv infection adult kingdom of spain sweden male )2020-01-14v3No1 / 519
666amnoncommon feces, italy, vicugna pacos, alpaca2020-09-25v3No1 / 546
273amnon high in age age one year compared to age one month in feces homo sapiens infant kingdom of denmark 2018-01-14v4No1 / 557
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in age age > 1 year compared to age <1 year in feces homo sapiens infant finland )2017-11-12v4No1 / 567
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in age 30-50 age 60-79 age >94 compared to age 19-24 soldiers in feces homo sapiens china )2018-12-30v4No1 / 617
666amnoncommon feces, italy, ovis aries musimon, mouflon2020-09-25v3No1 / 649
565amnoncommon zoological garden, skin, captive, canada, tragelaphus oryx, toronto zoo, eland2019-11-21v3No1 / 674
666amnoncommon feces, italy, capra hircus, goat2020-09-25v3No1 / 674
666amnoncommon feces, ovis aries, italy, sheep2020-09-25v3No1 / 688
752sheryoCommon in soil planted with Panax notoginseng amended with2% biochar (common soil, yunnan province, ph 6, biochar, china, panax notoginseng, pot expreiment, xundian county, sanqi plants)2021-03-11v3No1 / 783
649amnon high in colon compared to ileum in research facility ovis aries new zealand sheep lamb age 6 weeks 2020-09-07v3No1 / 897
649amnon high in colon compared to duodenum jejunum in research facility ovis aries new zealand sheep lamb age 6 weeks 2020-09-07v3No1 / 1261

Problems / suggestions? Please email info AT dbbact DOT org