Search result for sequence:
TACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGAGTGGCAAGTCTGATGTGAAAACCCGGGGCTCAACCCCGGGACTGCATTGGAAACTGTCAATCTGGAGTACCGGAGAGGTAAGCGGAATTCCTAG
common ontology terms
term enrichment score
TermScore
feces0.320630
homo sapiens0.320570
child0.252252
adult0.220339
italy0.135417
infant0.098765
hunter gatherer0.098361
united states of america0.098203
rural community0.093023
china0.088106
zoological garden0.087912
obsolete_juvenile stage0.076531
kingdom of spain0.076087
control0.072603
female0.070211
venezuela0.066667
amerindian0.066667
tanzania0.065574
africa0.065574
sweden0.062500
obesity0.061538
sheep0.059701
monkey0.059701
ovis aries0.057971
male0.055118
age 2-4 years0.050633
madagascar0.050633
estonia0.050633
age 5-13 years0.050633
wastewater treatment plant0.049383
age 30-500.048780
formula fed0.048780
macaca mulatta0.048780
biopsy0.048193
LOWER IN city0.048193
gay0.047619
guangzhou city prefecture0.046512
heterosexual0.046512
msw0.046512
homosexual0.045455
msm0.045455
high bmi0.044944
LOWER IN wild0.044944
LOWER IN adult0.043796
captive0.043011
city0.042105
hiv infection0.041667
colon0.041237
skin0.040816
lama guanicoe0.033898
midwest region0.033898
kebbi state0.033898
pemba island0.033898
nephrolithiasis0.033898
nanning city prefecture0.033898
age 50-60 years0.033898
sesame allergy0.033898
age 4-10 years0.033898
rhesus macaque0.033898
age 8 months0.033898
indonesia0.033898
municipality of yogyakarta0.033898
antananarivo0.033898
hmong0.033898
age 130.033898
lake hulun0.033898
hadza0.033898
pan troglodytes0.033898
chimpanzee0.033898
chuquisaca department0.033898
LOWER IN republic of congo0.033898
LOWER IN nouabale-ndoki national park0.033898
nigeria0.033333
food allergy0.033333
toronto0.033333
south america0.033333
age < 3 years0.033333
papio anubis0.033333
systemic lupus erythematosus0.032787
germany0.032787
age 10-15 years0.032787
diarrhea0.032787
russia0.032787
biopsy site0.032787
state of new york0.032787
kingdom of norway0.032787
LOWER IN finland0.032787
bolivia0.032787
new zealand0.032787
lamb0.032787
LOWER IN infant0.032520
mongolia0.032258
rectum0.032258
LOWER IN duodenum0.032258
age 6 weeks0.032258
duodenum0.032000
LOWER IN crohn&#39;s disease0.032000
thailand0.031746
juvenile organism0.031746
LOWER IN mouth mucosa0.031746
Fraction of dbbact annotations with this term covered by the query
TermScore
hunter gatherer0.750000
age 2-4 years0.666667
madagascar0.666667
estonia0.666667
age 5-13 years0.666667
venezuela0.666667
amerindian0.666667
lama guanicoe0.500000
age 7 months0.500000
age 25-50 years0.500000
midwest region0.500000
LOWER IN chronic fatigue syndrome0.500000
new york county0.500000
LOWER IN schistosomiasis0.500000
LOWER IN urinary schistosomiasis0.500000
kebbi state0.500000
panthera tigris0.500000
tiger0.500000
tanzania0.500000
pemba island0.500000
nephrolithiasis0.500000
nanning city prefecture0.500000
age 50-60 years0.500000
salmonella gastroenteritis0.500000
LOWER IN cron diet0.500000
sesame allergy0.500000
LOWER IN milk allergy0.500000
age 4-10 years0.500000
LOWER IN state of oregon0.500000
rhesus macaque0.500000
age 8 months0.500000
santa catarina state0.500000
indonesia0.500000
municipality of yogyakarta0.500000
africa0.500000
antananarivo0.500000
quito0.500000
age 2-5 years0.500000
novosibirsk0.500000
felis silvestris0.500000
wild cat0.500000
hmong0.500000
LOWER IN central african republic0.500000
LOWER IN bangui0.500000
LOWER IN age 7 months0.500000
age one month0.500000
LOWER IN age one week0.500000
cornell university0.500000
mild0.500000
LOWER IN severe0.500000
cayo santiago0.500000
indian rhesus macaque0.500000
gannan tibetan autonomous prefecture0.500000
LOWER IN gangcha region0.500000
LOWER IN exocrine pancreatic insufficiency0.500000
LOWER IN myanmar0.500000
LOWER IN karen0.500000
age 130.500000
LOWER IN cuba0.500000
LOWER IN india0.500000
age 30-400.500000
oslo0.500000
lake hulun0.500000
vulpes corsac0.500000
corsac fox0.500000
glasgow0.500000
sewer0.500000
low income0.500000
vulpes vulpes0.500000
red fox0.500000
bangladesh0.500000
age<17 years0.500000
hadza0.500000
suckling0.500000
preweaned0.500000
age 2-4 weeks0.500000
ngoantet0.500000
LOWER IN yaounde0.500000
bogota0.500000
LOWER IN municipality of santiago de cali0.500000
LOWER IN bucaramanga0.500000
LOWER IN barranquilla0.500000
age 3-60.500000
age 8-120.500000
LOWER IN age 30-500.500000
LOWER IN age 60-790.500000
LOWER IN acute pancreatitis0.500000
LOWER IN pancreatitis0.500000
LOWER IN age 0-6 months0.500000
LOWER IN papio kindae0.500000
LOWER IN papio ursinus0.500000
papio0.500000
zambia0.500000
baboon0.500000
pan troglodytes0.500000
chimpanzee0.500000
sewage0.500000
LOWER IN effluent0.500000
children0.500000
new delhi0.500000
Fraction of annotations for the query sequences containing the term
TermScore
feces0.868421
homo sapiens0.728070
adult0.333333
child0.184211
united states of america0.184211
china0.131579
italy0.114035
control0.114035
infant0.070175
female0.061404
kingdom of spain0.061404
male0.061404
sweden0.052632
rural community0.052632
hunter gatherer0.052632
zoological garden0.052632
obsolete_juvenile stage0.043860
ovis aries0.035088
sheep0.035088
tanzania0.035088
research facility0.035088
monkey0.035088
africa0.035088
obesity0.035088
venezuela0.035088
amerindian0.035088
age 2-4 years0.026316
guangzhou city prefecture0.026316
age 30-500.026316
germany0.026316
formula fed0.026316
heterosexual0.026316
msw0.026316
hiv infection0.026316
LOWER IN control0.026316
macaca mulatta0.026316
captive0.026316
madagascar0.026316
gay0.026316
homosexual0.026316
msm0.026316
estonia0.026316
high bmi0.026316
age 5-13 years0.026316
biopsy0.026316
LOWER IN adult0.026316
wastewater treatment plant0.026316
city0.026316
LOWER IN city0.026316
LOWER IN wild0.026316
colon0.026316
skin0.026316
lama guanicoe0.017544
systemic lupus erythematosus0.017544
age 1 year0.017544
midwest region0.017544
nigeria0.017544
kebbi state0.017544
age 10-15 years0.017544
zhejiang province0.017544
pemba island0.017544
nephrolithiasis0.017544
nanning city prefecture0.017544
age 50-60 years0.017544
diarrhea0.017544
sesame allergy0.017544
israel0.017544
food allergy0.017544
age 4-10 years0.017544
rhesus macaque0.017544
age 8 months0.017544
indonesia0.017544
municipality of yogyakarta0.017544
antananarivo0.017544
russia0.017544
thailand0.017544
hmong0.017544
biopsy site0.017544
duodenum0.017544
age0.017544
kingdom of denmark0.017544
state of new york0.017544
toronto0.017544
canis lupus familiaris0.017544
dog0.017544
juvenile organism0.017544
finland0.017544
age 130.017544
LOWER IN infant0.017544
kingdom of norway0.017544
mongolia0.017544
winter0.017544
wild0.017544
lake hulun0.017544
LOWER IN feces0.017544
south america0.017544
LOWER IN finland0.017544
age < 3 years0.017544
hadza0.017544
LOWER IN ileum0.017544
Exp. ID User ID Description Date Region Flag Sequences
666amnondominant feces, ovis aries, italy, sheep2020-09-25v3No1 / 7
564amnon high in control compared to autistic disorder in feces homo sapiens child italy age 2-4 years 2019-11-18v3No1 / 14
666amnondominant feces, italy, lama guanicoe2020-09-25v3No1 / 18
707amnondominant feces, homo sapiens, female, adult, guangzhou city prefecture, age 30-50, systemic lupus erythematosus, china2028-04-11v3No1 / 22
797amnondominant feces, homo sapiens, infant, germany, age 1 year, formula fed2021-06-13v3No1 / 25
578amnondominant feces, homo sapiens, control, adult, kingdom of spain, sweden, heterosexual, msw, male2020-01-14v3No1 / 26
797amnon high in formula fed compared to breast fed in feces homo sapiens infant germany age 7 months 2021-06-13v3No1 / 31
745amnon high in age 25-50 years compared to age 50-80 years in feces homo sapiens united states of america adult midwest region 2021-02-25v3No1 / 32
12amnon high in control compared to chronic fatigue syndrome in feces homo sapiens new york county 2016-11-02v4No1 / 35
509amnon high in control compared to schistosomiasis urinary schistosomiasis in feces homo sapiens child nigeria kebbi state rural community age 10-15 years 2019-03-18v4No1 / 35
666amnoncommon feces, italy, panthera tigris, tiger2020-09-25v3No1 / 43
597amnoncommon feces, homo sapiens, control, adult, zhejiang province, china2020-03-23v3No1 / 46
597amnoncommon feces, homo sapiens, adult, zhejiang province, gout, china2020-03-23v3No1 / 47
736amnoncommon feces, homo sapiens, child, tanzania, age 1-3 years, pemba island2021-01-25v3No1 / 49
564amnoncommon feces, homo sapiens, control, child, italy, age 2-4 years2019-11-18v3No1 / 50
578amnoncommon feces, homo sapiens, hiv infection, adult, kingdom of spain, sweden, heterosexual, msw, male2020-01-14v3No1 / 53
286amnonhigher in feces of individuals with kidney stones ( high in nephrolithiasis compared to control in feces homo sapiens adult nanning city prefecture age 50-60 years china )2018-01-27v4No1 / 54
390amnoncommon feces, homo sapiens, hospital, salmonella gastroenteritis, australia, diarrhea2018-11-04v4No1 / 55
707amnoncommon feces, homo sapiens, female, adult, guangzhou city prefecture, age 30-50, systemic lupus erythematosus, china2028-04-11v3No1 / 55
745amnoncommon feces, homo sapiens, united states of america, adult, midwest region2021-02-25v3No1 / 55
293amnonlower in caloric restriction (CRON) diet compared to american diet ( high in diet american diet compared to cron diet caloric restriction diet in feces homo sapiens united states of america adult )2018-02-07v4No1 / 61
695amnon high in sesame allergy compared to milk allergy in feces homo sapiens child israel food allergy age 4-10 years 2028-03-27v4No1 / 64
671amnon high in state of california compared to state of oregon in feces united states of america research facility macaca mulatta monkey captive rhesus macaque age 8 months 2020-09-27v4No1 / 66
757amnoncommon feces, homo sapiens, adult, brazil, santa catarina state2021-03-28v3No1 / 67
723amnoncommon feces, homo sapiens, female, adult, indonesia, municipality of yogyakarta2021-01-02v3No1 / 69
425amnoncommon feces, homo sapiens, child, africa, madagascar, antananarivo2018-12-08v4No1 / 73
578amnoncommon feces, homo sapiens, hiv infection, adult, kingdom of spain, sweden, gay, homosexual, msm, male2020-01-14v3No1 / 74
799amnoncommon in obese participant fecal samples before ketogenic diet (common feces, homo sapiens, obesity, adult, estonia, high bmi)2021-06-13v3No1 / 77
630amnoncommon feces, homo sapiens, adult, kingdom of spain, madrid2020-06-01v3No1 / 78
695amnoncommon feces, homo sapiens, child, israel, food allergy, age 4-10 years, sesame allergy2028-03-27v4No1 / 80
562amnoncommon feces, child, ecuador, age 5-13 years, quito2019-11-05v4No1 / 82
707amnoncommon feces, homo sapiens, female, adult, guangzhou city prefecture, age 30-50, china2028-04-11v3No1 / 82
247amnoncommon feces, homo sapiens, italy, high bmi, obesity2017-11-21v4No1 / 85
804amnon high in iga negative fraction compared to iga positive fraction in feces homo sapiens child africa central african republic madagascar age 2-5 years 2021-06-18v4No1 / 85
680amnoncommon feces, homo sapiens, obesity, adult, russia, novosibirsk2028-03-04v3No1 / 85
666amnoncommon feces, italy, felis silvestris, wild cat2020-09-25v3No1 / 91
578amnoncommon feces, homo sapiens, control, adult, kingdom of spain, sweden, heterosexual, msw, male2020-01-14v3No1 / 92
799amnoncommon in obese participant fecal samples after 1 month ketogenic diet (common feces, homo sapiens, obesity, adult, estonia, high bmi, ketogenic diet)2021-06-13v3No1 / 93
400amnoncommon in hmong (chinese) females from thailand (common feces, homo sapiens, female, adult, thailand, hmong, china)2018-11-18v4No1 / 95
736amnoncommon feces, homo sapiens, female, adult, tanzania, pemba island2021-01-25v3No1 / 95
409amnoncommon homo sapiens, united states of america, right colon, biopsy site, adult, biopsy2018-11-22v4No1 / 97
425amnon high in madagascar antananarivo compared to central african republic bangui in homo sapiens duodenum child africa 2018-12-08v4No1 / 103
797amnon high in age 1 year compared to age 7 months in feces homo sapiens infant germany formula fed 2021-06-13v3No1 / 106
273amnon high in age age one month compared to age one week in feces homo sapiens infant kingdom of denmark 2018-01-14v4No1 / 107
802amnoncommon feces, homo sapiens, united states of america, adult, state of new york, cornell university2021-06-16v4No1 / 108
410amnonlower in severe treatment naive ulcerative colitis patients compared to mild ( high in mild compared to severe ulcerative colitis in feces homo sapiens united states of america child )2018-11-22v4No1 / 110
770amnon high in infant age < 1 year compared to age 10-15 years adult organism in feces macaca mulatta cayo santiago puerto rico rectal swab indian rhesus macaque 2021-04-19v4No1 / 111
409amnoncommon homo sapiens, united states of america, left colon, biopsy site, adult, biopsy2018-11-22v4No1 / 118
371amnoncommon feces, homo sapiens, venezuela, amerindian, hunter gatherer2018-09-06v4No1 / 121
380amnon high in gannan tibetan autonomous prefecture compared to gangcha region in feces homo sapiens adult tibetan plateau tibet autonomous region 2018-10-03v4No1 / 123
10amnonnegatively correlated with age (6-35) ( high in child compared to adult in feces homo sapiens toronto )2016-10-27v4No1 / 125
150amnonhigh in healthy dogs compared to EPI dogs without treatment ( high in control compared to exocrine pancreatic insufficiency in feces united states of america canis lupus familiaris dog )2017-04-26v4No1 / 126
578amnoncommon feces, homo sapiens, control, adult, kingdom of spain, sweden, gay, homosexual, msm, male2020-01-14v3No1 / 132
400amnonhigher in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in hmong china compared to myanmar karen in feces homo sapiens thailand rural community )2018-11-18v4No1 / 135
197amnoncommon feces, homo sapiens, juvenile organism, finland, obsolete_juvenile stage, age 132017-09-12v4No1 / 136
644amnonhigher in individuals born in mexico compared to cuba ( high in mexico compared to cuba in feces homo sapiens united states of america adult hispanic or latin american )2020-08-31v4No1 / 136
10amnoncommon feces, homo sapiens, toronto2016-10-27v4No1 / 138
197amnon high in finland compared to india in feces homo sapiens juvenile organism obsolete_juvenile stage age 13 2017-09-12v4No1 / 138
330amnon high in adult age 30-40 compared to infant age 1 year in feces homo sapiens kingdom of norway oslo 2018-05-13v4No1 / 145
815amnoncommon feces, mongolia, winter, wild, lake hulun, vulpes corsac, corsac fox2021-07-04v3No1 / 146
73amnoncommon feces, homo sapiens, adult, glasgow2017-02-26v4No1 / 147
509amnoncommon feces, homo sapiens, control, child, nigeria, kebbi state, rural community, age 10-15 years2019-03-18v4No1 / 147
53amnonhigher in sewer and wastewater influent comapred to feces in low income south america ( high in wastewater treatment plant sewer compared to feces in city south america low income )2017-01-21v4No1 / 148
241amnonlower in babies from finland compared to estonia ( high in estonia compared to finland in feces homo sapiens infant age < 3 years )2017-11-13v4No1 / 157
815amnoncommon feces, mongolia, winter, wild, vulpes vulpes, lake hulun, red fox2021-07-04v3No1 / 160
121amnonhigh in diarrhea compared to recovery period ( high in diarrhea compared to control in feces homo sapiens adult bangladesh )2017-04-13v4No1 / 162
297amnoncommon feces, homo sapiens, united states of america, child, atlanta, obsolete_juvenile stage, age<17 years2018-02-12v4No1 / 162
190amnoncommon feces, homo sapiens, tanzania, hunter gatherer, hadza2017-09-04v4No1 / 169
194amnon high in feces compared to colon ileum in homo sapiens kingdom of norway 2017-09-07v4No1 / 169
521amnoncommon in pre-weaned pigs (common feces, farm, sus scrofa, jiangxi province, pig, suckling, preweaned, age 2-4 weeks, china)2019-07-02v3No1 / 169
594amnon high in rural community ngoantet compared to city yaounde in feces homo sapiens adult cameroon 2020-03-12v4No1 / 172
671amnon high in age 8 months compared to female adult in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 2020-09-27v4No1 / 182
150amnoncommon feces, united states of america, canis lupus familiaris, dog2017-04-26v4No1 / 208
310amnoncommon feces, homo sapiens, female, rectum, adult, poland2018-04-07v4No1 / 227
404amnon high in bogota medellin metropolitan area compared to municipality of santiago de cali bucaramanga barranquilla in feces homo sapiens city adult colombia 2018-11-20v4No1 / 237
286amnoncommon in feces of individuals with kidney stones (common feces, homo sapiens, adult, nanning city prefecture, age 50-60 years, nephrolithiasis, china)2018-01-27v4No1 / 239
398amnon high in control compared to crohn's disease in feces homo sapiens belgium 2018-11-15v4No1 / 248
63amnon high in male compared to female in feces homo sapiens united states of america 2017-12-04v4No1 / 262
438amnon high in child age 3-6 age 8-12 compared to adult age 30-50 age 60-79 in feces homo sapiens china 2018-12-30v4No1 / 279
428amnon high in control compared to acute pancreatitis pancreatitis in feces homo sapiens adult nanchang city prefecture china 2018-12-09v4No1 / 288
411amnoncommon feces, united states of america, zoological garden, papio anubis, monkey, olive baboon2018-11-23v4No1 / 292
723amnon high in age 2-4 years compared to infant age 0-6 months in feces homo sapiens child indonesia municipality of yogyakarta 2021-01-02v3No1 / 305
241amnonhigher in babies from russia compared to finland ( high in russia compared to finland in feces homo sapiens infant age < 3 years )2017-11-13v4No1 / 306
650amnon high in asian compared to caucasian european in feces homo sapiens united states of america adult state of new york 2020-09-12v4No1 / 317
299amnon high in mouth neoplasm cancer compared to control in homo sapiens saliva adult china 2018-02-27v4No1 / 319
190amnon high in wet season compared to dry season in feces homo sapiens tanzania hunter gatherer hadza 2017-09-04v4No1 / 341
411amnon high in zoological garden papio anubis compared to wild papio kindae papio ursinus in feces papio zambia monkey baboon 2018-11-23v4No1 / 364
62amnoncommon feces, homo sapiens, united states of america, child, obsolete_juvenile stage2017-02-13v4No1 / 373
399amnoncommon feces, united states of america, state of tennessee, zoological garden, pan troglodytes, chimpanzee2018-11-16v4No1 / 407
425amnon high in feces compared to duodenum in homo sapiens child africa 2018-12-08v4No1 / 416
62amnoncommon feces, homo sapiens, child, egypt, obsolete_juvenile stage2017-02-13v4No1 / 422
666amnoncommon feces, italy, lama guanicoe2020-09-25v3No1 / 437
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in city wastewater treatment plant south america )2017-01-21v4No1 / 440
75amnoncommon feces, homo sapiens, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 442
371amnonhigher in amerindians compared to western visitors ( high in venezuela amerindian hunter gatherer compared to united states of america city in feces homo sapiens )2018-09-06v4No1 / 443
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in homo sapiens united states of america rectum caecum colon sigmoid colon terminal ileum biopsy children )2016-11-14v4No1 / 459
160amnoncommon in wastewater treatment plant effluent in autumn in china (common wastewater treatment plant, effluent, autumn, china)2017-07-12v4No1 / 469
666amnoncommon feces, bos taurus, italy, cow2020-09-25v3No1 / 482
578amnonhigher in gay (msm) individuals compared to heterosexual (msw) ( high in gay homosexual msm compared to heterosexual msw in feces homo sapiens hiv infection adult kingdom of spain sweden male )2020-01-14v3No1 / 519
352amnon high in small intestine duodenum compared to feces in homo sapiens new delhi india 2018-07-30v4No1 / 545
666amnoncommon feces, italy, vicugna pacos, alpaca2020-09-25v3No1 / 546
273amnon high in age age one year compared to age one month in feces homo sapiens infant kingdom of denmark 2018-01-14v4No1 / 557
666amnoncommon feces, italy, ovis aries musimon, mouflon2020-09-25v3No1 / 649
565amnoncommon zoological garden, skin, captive, canada, tragelaphus oryx, toronto zoo, eland2019-11-21v3No1 / 674
666amnoncommon feces, italy, capra hircus, goat2020-09-25v3No1 / 674
666amnoncommon feces, ovis aries, italy, sheep2020-09-25v3No1 / 688
517amnon high in feces compared to mouth mucosa mouth in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 752
752sheryoCommon in soil planted with Panax notoginseng amended with2% biochar (common soil, yunnan province, ph 6, biochar, china, panax notoginseng, pot expreiment, xundian county, sanqi plants)2021-03-11v3No1 / 783
371amnonhigher in skin of amerindians compared to western visitors ( high in venezuela amerindian hunter gatherer compared to united states of america city in homo sapiens skin )2018-09-06v4No1 / 854
649amnon high in colon compared to ileum in research facility ovis aries new zealand sheep lamb age 6 weeks 2020-09-07v3No1 / 897
620amnon high in united states of america zoological garden pan troglodytes compared to wild pan troglodytes troglodytes republic of congo nouabale-ndoki national park in feces chimpanzee 2020-05-06v4No1 / 964
517amnon high in arm skin forearm compared to mouth mucosa mouth in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 1014
620amnon high in united states of america zoological garden compared to wild republic of congo nouabale-ndoki national park in feces gorilla gorilla gorilla 2020-05-06v4No1 / 1019
649amnon high in colon compared to duodenum jejunum in research facility ovis aries new zealand sheep lamb age 6 weeks 2020-09-07v3No1 / 1261

Problems / suggestions? Please email info AT dbbact DOT org