Search result for sequence:
TACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCGAAGCAAGTCTGAAGTGAAAACCCAGGGCTCAACCCTGGGACTGCTTTGGAAACTGTTTTGCTAGAGTGTCGGAGAGGTAAGTGGAATTCCTAG
common ontology terms
term enrichment score
TermScore
feces0.397624
homo sapiens0.386879
adult0.250277
united states of america0.243044
infant0.189361
crohn's disease0.143985
LOWER IN control0.136541
research facility0.128313
china0.126090
child0.119729
ulcerative colitis0.110803
mouse0.107417
mus musculus0.103110
human adult stage0.101010
state of california0.095563
formula fed0.083176
control0.077478
biopsy0.071856
canada0.071568
c57bl/60.067692
guangzhou city prefecture0.067039
clostridium difficile intestinal infectious disease0.064257
germany0.062016
italy0.061100
hospital0.060683
hispanic or latin american0.055777
caecum0.050729
terminal ileum0.048980
obsolete_juvenile stage0.047619
12-month-old human stage0.047431
farm0.047106
rectum0.047059
adolescent stage0.046693
6-12 year-old child stage0.046693
wild0.046667
antibiotic0.045977
taconic farms0.045977
age 8 weeks0.045977
australia0.045259
city0.045147
kingdom of spain0.043716
age < 3 years0.040900
juvenile0.040900
oryctolagus cuniculus0.039683
1-year-old human stage0.039293
state of georgia0.038911
diarrhea0.038536
monkey0.038536
finland0.038168
french republic0.038168
horse0.038168
rectal swab0.037927
equus caballus0.037807
captive0.036265
LOWER IN 1-month-old human stage0.032922
sigmoid colon0.032653
LOWER IN rural community0.032653
los angeles district0.032653
seattle0.032653
colonized germ free0.032653
clostridium difficile infection0.032389
LOWER IN breast fed0.032389
rabbit0.032389
hispanic0.032129
diabetic retinopathy0.032129
female0.031847
sus scrofa0.030809
pig0.030809
rat0.030809
state of new york0.030418
colitis0.030189
colon0.028269
biopsy site0.024896
calgary0.024845
state of oklahoma0.024691
phascolarctos cinereus0.024691
koala0.024691
cape otway0.024691
tucson0.024691
los angeles0.024691
hyplus rabbit0.024691
cholangiocarcinoma0.024691
remission0.024540
nanning city prefecture0.024390
sixth decade human stage0.024390
cystic fibrosis0.024390
LOWER IN under-1-year-old human stage0.024291
juvenile organism0.024242
disease0.024096
LOWER IN jackson laboratories0.024096
macaca mulatta0.024096
age 5 weeks0.024096
state of michigan0.023952
rattus norvegicus0.023669
rural community0.023622
c57bl/6j0.023529
commonwealth of pennsylvania0.023529
6-month-old human stage0.023529
age0.023256
3-month-old human stage0.023256
Fraction of dbbact annotations with this term covered by the query
TermScore
terminal ileum0.750000
biopsy site0.750000
crohn's disease0.705882
biopsy0.666667
clostridium difficile intestinal infectious disease0.666667
bangladesh0.666667
age < 3 years0.666667
LOWER IN 1-month-old human stage0.666667
age 3-5 weeks0.666667
calgary0.666667
juvenile0.666667
chronic fatigue syndrome0.500000
new york county0.500000
sigmoid colon0.500000
children0.500000
mammalian milk beverage0.500000
lima0.500000
shantytown0.500000
LOWER IN el salado0.500000
LOWER IN small village0.500000
LOWER IN egypt0.500000
LOWER IN plant diet0.500000
13-year-old human stage0.500000
LOWER IN bacterial vaginosis0.500000
LOWER IN ulcer0.500000
LOWER IN wound0.500000
LOWER IN russia0.500000
LOWER IN estonia0.500000
state of oklahoma0.500000
cheyenne0.500000
native american0.500000
arapaho0.500000
epilithic0.500000
little physical activity0.500000
LOWER IN physical activity0.500000
LOWER IN peru0.500000
LOWER IN tunapuco0.500000
LOWER IN rural community0.500000
LOWER IN age 2 months0.500000
nephrolithiasis0.500000
age<17 years0.500000
cancer0.500000
spondyloarthritis0.500000
spondylitis0.500000
oslo0.500000
denver0.500000
LOWER IN venezuela0.500000
LOWER IN amerindian0.500000
gangcha region0.500000
LOWER IN gannan tibetan autonomous prefecture0.500000
age 1-3 weeks0.500000
hmong0.500000
LOWER IN myanmar0.500000
LOWER IN karen0.500000
low fiber0.500000
farm 10.500000
LOWER IN farm 20.500000
jinhua city prefecture0.500000
jinhua pig0.500000
acute pancreatitis0.500000
pancreatitis0.500000
age 3-60.500000
LOWER IN age 8-120.500000
LOWER IN age 13-140.500000
LOWER IN 6-12 year-old child stage0.500000
age >940.500000
tenth decade human stage0.500000
age 13-140.500000
non-steroidal anti-inflammatory drug0.500000
indomethacin0.500000
cefoperazone0.500000
equine grass sickness0.500000
atherosclerosis0.500000
LOWER IN nepal0.500000
LOWER IN himalayas0.500000
eucalyptus viminalis0.500000
eucalyptus viminalis diet0.500000
LOWER IN eucalyptus obliqua diet0.500000
LOWER IN eucalyptus obliqua0.500000
phascolarctos cinereus0.500000
koala0.500000
cape otway0.500000
eucalyptus obliqua diet0.500000
perianal skin0.500000
urocyon littoralis0.500000
urocyon littoralis catalinae0.500000
santa catalina island fox0.500000
LOWER IN external acoustic meatus0.500000
LOWER IN ear canal0.500000
high fat diet + inulin0.500000
trachemys scripta elegans0.500000
red-eared slider turtle0.500000
turtle farm0.500000
acquired immunodeficiency syndrome0.500000
hispanic or latin american0.500000
usa born0.500000
LOWER IN non usa born0.500000
LOWER IN mexico0.500000
LOWER IN amoxicillin0.500000
LOWER IN doxycycline0.500000
Fraction of annotations for the query sequences containing the term
TermScore
feces0.856540
homo sapiens0.725738
united states of america0.375527
adult0.341772
china0.181435
research facility0.160338
LOWER IN control0.135021
infant0.130802
mus musculus0.088608
mouse0.088608
crohn's disease0.080169
child0.080169
control0.075949
ulcerative colitis0.063291
human adult stage0.063291
state of california0.059072
germany0.050633
canada0.046414
c57bl/60.046414
formula fed0.046414
biopsy0.037975
guangzhou city prefecture0.037975
italy0.037975
caecum0.033755
clostridium difficile intestinal infectious disease0.033755
hospital0.033755
australia0.029536
farm0.029536
wild0.029536
hispanic or latin american0.029536
rectum0.025316
terminal ileum0.025316
antibiotic0.025316
city0.025316
obsolete_juvenile stage0.025316
kingdom of spain0.025316
12-month-old human stage0.025316
adolescent stage0.025316
taconic farms0.025316
age 8 weeks0.025316
6-12 year-old child stage0.025316
oryctolagus cuniculus0.021097
diarrhea0.021097
1-year-old human stage0.021097
finland0.021097
age < 3 years0.021097
female0.021097
french republic0.021097
equus caballus0.021097
horse0.021097
state of georgia0.021097
monkey0.021097
captive0.021097
rectal swab0.021097
juvenile0.021097
colon0.016878
sigmoid colon0.016878
LOWER IN 1-month-old human stage0.016878
LOWER IN rural community0.016878
sus scrofa0.016878
pig0.016878
rat0.016878
state of new york0.016878
clostridium difficile infection0.016878
LOWER IN breast fed0.016878
los angeles district0.016878
hispanic0.016878
colitis0.016878
rabbit0.016878
seattle0.016878
colonized germ free0.016878
diabetic retinopathy0.016878
biopsy site0.012658
LOWER IN adult0.012658
state of michigan0.012658
c57bl/6j0.012658
juvenile organism0.012658
age0.012658
LOWER IN under-1-year-old human stage0.012658
state of oklahoma0.012658
LOWER IN male0.012658
nanning city prefecture0.012658
sixth decade human stage0.012658
rural community0.012658
commonwealth of pennsylvania0.012658
rattus norvegicus0.012658
jiangsu province0.012658
disease0.012658
LOWER IN jackson laboratories0.012658
phascolarctos cinereus0.012658
koala0.012658
cape otway0.012658
jackson laboratories0.012658
macaca mulatta0.012658
tucson0.012658
6-month-old human stage0.012658
cystic fibrosis0.012658
adult organism0.012658
los angeles0.012658
calgary0.012658
Number of experiments associating the term to the sequence
TermScore
feces109.000000
homo sapiens96.000000
united states of america53.000000
adult46.000000
LOWER IN control29.000000
research facility20.000000
china20.000000
control17.000000
child13.000000
crohn's disease12.000000
infant12.000000
mus musculus9.000000
mouse9.000000
human adult stage9.000000
state of california8.000000
ulcerative colitis8.000000
biopsy6.000000
caecum5.000000
antibiotic5.000000
city5.000000
female5.000000
farm5.000000
canada5.000000
italy5.000000
rectum4.000000
obsolete_juvenile stage4.000000
clostridium difficile intestinal infectious disease4.000000
1-year-old human stage4.000000
kingdom of spain4.000000
LOWER IN 1-month-old human stage4.000000
LOWER IN rural community4.000000
wild4.000000
monkey4.000000
captive4.000000
terminal ileum3.000000
oryctolagus cuniculus3.000000
biopsy site3.000000
LOWER IN adult3.000000
australia3.000000
age3.000000
LOWER IN under-1-year-old human stage3.000000
LOWER IN male3.000000
12-month-old human stage3.000000
rural community3.000000
adolescent stage3.000000
french republic3.000000
sus scrofa3.000000
pig3.000000
hospital3.000000
rat3.000000
c57bl/63.000000
6-12 year-old child stage3.000000
rectal swab3.000000
colon2.000000
sigmoid colon2.000000
LOWER IN small village2.000000
state of michigan2.000000
diarrhea2.000000
bangladesh2.000000
c57bl/6j2.000000
juvenile organism2.000000
13-year-old human stage2.000000
finland2.000000
age < 3 years2.000000
state of oklahoma2.000000
cancer2.000000
commonwealth of pennsylvania2.000000
rattus norvegicus2.000000
disease2.000000
equus caballus2.000000
horse2.000000
state of georgia2.000000
age 3-5 weeks2.000000
hispanic or latin american2.000000
state of new york2.000000
macaca mulatta2.000000
clostridium difficile infection2.000000
guangzhou city prefecture2.000000
formula fed2.000000
LOWER IN breast fed2.000000
cystic fibrosis2.000000
rabbit2.000000
calgary2.000000
juvenile2.000000
remission2.000000
germany2.000000
chronic fatigue syndrome1.000000
new york county1.000000
children1.000000
mammalian milk beverage1.000000
lima1.000000
shantytown1.000000
LOWER IN el salado1.000000
LOWER IN egypt1.000000
LOWER IN plant diet1.000000
LOWER IN bacterial vaginosis1.000000
LOWER IN ulcer1.000000
LOWER IN wound1.000000
LOWER IN russia1.000000
LOWER IN estonia1.000000
cheyenne1.000000
native american1.000000
arapaho1.000000
epilithic1.000000
little physical activity1.000000
LOWER IN physical activity1.000000
LOWER IN peru1.000000
LOWER IN tunapuco1.000000
LOWER IN age 2 months1.000000
nephrolithiasis1.000000
nanning city prefecture1.000000
sixth decade human stage1.000000
age<17 years1.000000
spondyloarthritis1.000000
spondylitis1.000000
oslo1.000000
denver1.000000
LOWER IN venezuela1.000000
LOWER IN amerindian1.000000
gangcha region1.000000
LOWER IN gannan tibetan autonomous prefecture1.000000
age 1-3 weeks1.000000
hmong1.000000
LOWER IN myanmar1.000000
LOWER IN karen1.000000
low fiber1.000000
farm 11.000000
LOWER IN farm 21.000000
jinhua city prefecture1.000000
jinhua pig1.000000
acute pancreatitis1.000000
pancreatitis1.000000
age 3-61.000000
LOWER IN age 8-121.000000
LOWER IN age 13-141.000000
LOWER IN 6-12 year-old child stage1.000000
age >941.000000
tenth decade human stage1.000000
jiangsu province1.000000
age 13-141.000000
non-steroidal anti-inflammatory drug1.000000
indomethacin1.000000
cefoperazone1.000000
equine grass sickness1.000000
atherosclerosis1.000000
LOWER IN nepal1.000000
LOWER IN himalayas1.000000
taconic farms1.000000
LOWER IN jackson laboratories1.000000
age 8 weeks1.000000
eucalyptus viminalis1.000000
eucalyptus viminalis diet1.000000
LOWER IN eucalyptus obliqua diet1.000000
LOWER IN eucalyptus obliqua1.000000
phascolarctos cinereus1.000000
koala1.000000
cape otway1.000000
eucalyptus obliqua diet1.000000
perianal skin1.000000
urocyon littoralis1.000000
urocyon littoralis catalinae1.000000
santa catalina island fox1.000000
LOWER IN external acoustic meatus1.000000
LOWER IN ear canal1.000000
jackson laboratories1.000000
high fat diet + inulin1.000000
trachemys scripta elegans1.000000
red-eared slider turtle1.000000
turtle farm1.000000
acquired immunodeficiency syndrome1.000000
usa born1.000000
LOWER IN non usa born1.000000
LOWER IN mexico1.000000
LOWER IN amoxicillin1.000000
LOWER IN doxycycline1.000000
tucson1.000000
los angeles district1.000000
hispanic1.000000
6-month-old human stage1.000000
colitis1.000000
adult organism1.000000
los angeles1.000000
seattle1.000000
colonized germ free1.000000
3-month-old human stage1.000000
age 5 weeks1.000000
hyplus rabbit1.000000
diabetic retinopathy1.000000
cholangiocarcinoma1.000000
Exp. ID User ID Description Date Region Sequences Status Flag
385amnoncolonize probiotic supplemented mice following antibiotics treatment ( high in probiotic compared to control in feces research facility antibiotic mus musculus israel mouse )2018-10-23v41 / 3approvedNo
394amnon high in ulcerative colitis compared to control in feces homo sapiens united states of america adult state of california 2018-11-06v41 / 8approvedNo
294amnon high in irritable bowel syndrome compared to control in feces homo sapiens adult kingdom of spain 2018-02-09v41 / 9approvedNo
1036amnon high in type i diabetes mellitus type 1 diabetes mellitus compared to control in feces homo sapiens child china child stage 2023-08-15v31 / 9pendingNo
629amnon high in hiv infection acquired immunodeficiency syndrome compared to control in feces homo sapiens adult kingdom of the netherlands amsterdam 2020-05-31v41 / 10approvedNo
655amnoncommon in patients after hematopoietic stem cell transplant (common feces, homo sapiens, italy, after hcst, hematopoietic stem cell transplant)2020-09-13v31 / 10approvedNo
689amnoncommon feces, homo sapiens, united states of america, hospital, adult, non c. diff diarrhea, tucson2028-03-11v41 / 12approvedNo
502amnon high in schizophrenia compared to control in feces homo sapiens united states of america adult 2019-03-12v41 / 13approvedNo
51amnonlower in stool compared to biopsies ( high in biopsy site biopsy compared to feces in homo sapiens united states of america )2017-01-19v41 / 14approvedNo
185amnoncommon in patients with c. diff infection before treatment (common feces, homo sapiens, united states of america, state of minnesota, clostridium difficile intestinal infectious disease)2017-08-20v41 / 14approvedNo
779amnon high in crohn's disease compared to control in feces homo sapiens adult guangzhou city prefecture china 2021-04-28v41 / 15approvedNo
797amnon high in 12-month-old human stage compared to age 7 months in feces homo sapiens infant germany breast fed 2021-06-13v31 / 15approvedNo
94amnoncommon feces, homo sapiens, state of michigan, clostridium difficile intestinal infectious disease, diarrhea2017-03-12v41 / 16approvedNo
395amnonhigher in kids with ibd compared to healthy donors ( high in child inflammatory bowel disease crohn's disease ulcerative colitis compared to control in feces homo sapiens united states of america commonwealth of pennsylvania )2018-11-13v41 / 16approvedNo
659amnon high in before antibiotics compared to antibiotic vancomycin metronidazole amoxicillin doxycycline in feces homo sapiens ulcerative colitis child acute severe colitis 2020-09-19v41 / 16approvedNo
728amnoncommon feces, homo sapiens, hospital, adult, kingdom of spain, clostridium difficile intestinal infectious disease, clostridium difficile infection, valladolid2021-01-05v31 / 16approvedNo
368amnon high in systemic lupus erythematosus compared to control in feces homo sapiens united states of america adult commonwealth of virginia 2018-09-03v41 / 17approvedNo
981amnondominant united states of america, state of california, captive, primates, plecturocebus cupreus, rectal swab, titi monkey2022-12-25v31 / 17approvedNo
12amnon high in chronic fatigue syndrome compared to control in feces homo sapiens new york county 2016-11-02v41 / 18approvedNo
713amnondominant feces, homo sapiens, remission, crohn's disease2028-05-21v31 / 18approvedNo
330amnon high in infant age 1 year compared to adult fourth decade human stage in feces homo sapiens kingdom of norway oslo 2018-05-13v41 / 19approvedNo
689amnoncommon feces, homo sapiens, united states of america, hospital, clostridium difficile colitis, adult, clostridium difficile infection, tucson2028-03-11v41 / 19approvedNo
866amnon high in crohn's disease crohn's disease compared to control in feces homo sapiens united states of america adult human adult stage 2022-02-08v41 / 19approvedNo
292amnondominant feces, homo sapiens, adult, crohn's disease, china2018-02-05v41 / 20approvedNo
619amnondominant feces, united states of america, research facility, mus musculus, mouse, cystic fibrosis, seattle, cftr s489x, colonized germ free2020-05-04v31 / 20approvedNo
797amnondominant feces, homo sapiens, infant, germany, formula fed, age 7 months2021-06-13v31 / 20approvedNo
797amnondominant feces, homo sapiens, infant, germany, formula fed, 3-month-old human stage2021-06-13v31 / 20approvedNo
1078amnondominant homo sapiens, adult, canada, remission, crohn's disease, calgary, rectal swab, human adult stage2024-02-15v31 / 20pendingNo
24amnonappears on transition to cow milk ( high in mammalian milk beverage compared to breast milk in feces homo sapiens infant )2016-12-01v41 / 21approvedNo
779amnondominant feces, homo sapiens, adult, guangzhou city prefecture, crohn's disease, china2021-04-28v41 / 21approvedNo
859amnoncommon feces, homo sapiens, infant, state of california, formula fed, hispanic or latin american, los angeles district, hispanic, 6-month-old human stage2022-01-12v41 / 21approvedNo
728amnondominant feces, homo sapiens, hospital, adult, kingdom of spain, clostridium difficile intestinal infectious disease, clostridium difficile infection, valladolid2021-01-05v31 / 21approvedNo
853amnondominant research facility, oryctolagus cuniculus, french republic, cecal content, rabbit, caecum, juvenile, age 5 weeks, hyplus rabbit, solid food supplemented diet, solid food diet2021-12-20v31 / 21approvedNo
1059amnondominant feces, homo sapiens, adult, diabetic retinopathy, diabetic retinopathy, china, municipality of shanghai, human adult stage2023-10-13v31 / 21pendingNo
94amnondominant feces, homo sapiens, state of michigan, clostridium difficile intestinal infectious disease, diarrhea2017-03-12v41 / 22approvedNo
185amnonhigh freq. in patients with c. diff infection before treatment (dominant feces, homo sapiens, united states of america, state of minnesota, clostridium difficile intestinal infectious disease)2017-08-20v41 / 22approvedNo
689amnondominant feces, homo sapiens, united states of america, hospital, clostridium difficile colitis, adult, clostridium difficile infection, tucson2028-03-11v41 / 22approvedNo
779amnoncommon feces, homo sapiens, adult, guangzhou city prefecture, crohn's disease, china2021-04-28v41 / 22approvedNo
859amnondominant feces, homo sapiens, infant, state of california, formula fed, hispanic or latin american, los angeles district, hispanic, 1-month-old human stage2022-01-12v41 / 22approvedNo
619amnondominant feces, control, united states of america, research facility, mus musculus, mouse, seattle, colonized germ free2020-05-04v31 / 22approvedNo
655amnondominant in patients after hematopoietic stem cell transplant (dominant feces, homo sapiens, italy, after hcst, hematopoietic stem cell transplant)2020-09-13v31 / 22approvedNo
713amnoncommon feces, homo sapiens, remission, crohn's disease2028-05-21v31 / 22approvedNo
241amnoncommon in babies age < 3 years in finland (common feces, homo sapiens, infant, finland, age < 3 years)2017-11-13v41 / 23approvedNo
779amnondominant feces, homo sapiens, ulcerative colitis, adult, guangzhou city prefecture, china2021-04-28v41 / 23approvedNo
797amnoncommon feces, homo sapiens, infant, germany, formula fed, 12-month-old human stage2021-06-13v31 / 23approvedNo
1070amnondominant feces, homo sapiens, adult, cholangiocarcinoma, china, human adult stage2023-12-14v31 / 23pendingNo
390amnonhigher in patients with c. diff diarrhea compared to non-c. diff diarrhea ( high in clostridium difficile intestinal infectious disease compared to non c. diff diarrhea in feces homo sapiens hospital australia diarrhea )2018-11-04v41 / 24approvedNo
541amnonlower in koalas eating Eucalyptus obliqua leaves comapred to Eucalyptus viminalis ( high in eucalyptus viminalis eucalyptus viminalis diet compared to eucalyptus obliqua diet eucalyptus obliqua in feces australia phascolarctos cinereus koala cape otway wild )2019-08-01v41 / 24approvedNo
959amnondominant feces, homo sapiens, united states of america, ulcerative colitis, child, state of california, ulcerative colitis, los angeles, 6-12 year-old child stage, adolescent stage2022-12-19v41 / 24approvedNo
641amnoncommon feces, united states of america, research facility, juvenile organism, state of georgia, green turtle, chelonia mydas, juvenile2020-08-23v31 / 24approvedNo
641amnondominant feces, united states of america, research facility, juvenile organism, state of georgia, green turtle, chelonia mydas, juvenile2020-08-23v31 / 24approvedNo
853amnondominant research facility, caecum, oryctolagus cuniculus, french republic, cecal content, rabbit, juvenile, age 5 weeks, hyplus rabbit, exclusive breastmilk diet2021-12-20v31 / 24approvedNo
395amnoncommon feces, homo sapiens, united states of america, child, commonwealth of pennsylvania, inflammatory bowel disease, crohn's disease, ulcerative colitis2018-11-14v41 / 25approvedNo
428amnoncommon feces, homo sapiens, adult, nanchang city prefecture, acute pancreatitis, pancreatitis, china2018-12-09v41 / 25approvedNo
779amnoncommon feces, homo sapiens, ulcerative colitis, adult, guangzhou city prefecture, china2021-04-28v41 / 25approvedNo
714amnondominant homo sapiens, sigmoid colon, terminal ileum, biopsy, germany2028-05-21v31 / 25approvedNo
399amnondominant feces, united states of america, research facility, rattus norvegicus, rat2018-11-16v41 / 27approvedNo
399amnon high in crohn's disease compared to control in feces homo sapiens united states of america 2018-11-16v41 / 27approvedNo
1059amnon high in diabetic retinopathy diabetic retinopathy compared to control in feces homo sapiens adult china municipality of shanghai human adult stage 2023-10-13v31 / 27pendingNo
320amnoncommon feces, homo sapiens, adult, crohn's disease2018-04-19v41 / 30approvedNo
333amnonhigher in stroke patients compared to healthy controls ( high in stroke compared to control in feces homo sapiens adult guangzhou city prefecture china )2018-05-15v41 / 30approvedNo
390amnoncommon feces, homo sapiens, hospital, australia, clostridium difficile intestinal infectious disease, diarrhea2018-11-04v41 / 31approvedNo
655amnoncommon in patients before hematopoietic stem cell transplant (common feces, homo sapiens, italy, before hsct)2020-09-13v31 / 31approvedNo
797amnon high in formula fed compared to breast fed in feces homo sapiens infant germany age 7 months 2021-06-13v31 / 31approvedNo
404amnonnegatively correlated with fiber intake ( high in low fiber compared to high fiber plant fiber cell in feces homo sapiens city adult colombia )2018-11-20v41 / 32approvedNo
19amnonhigher in CD compared to control in biopsies ( high in crohn's disease compared to control in homo sapiens united states of america rectum caecum colon sigmoid colon terminal ileum biopsy children )2016-11-14v41 / 34approvedNo
284amnon high in 12-month-old human stage compared to age 2 months in feces homo sapiens female infant state of california 2018-01-27v41 / 35approvedNo
669amnoncommon feces, homo sapiens, infant, sweden, 12-month-old human stage2020-09-26v41 / 35approvedNo
240amnoncommon in infants age <3 years (common feces, homo sapiens, infant, finland, age < 3 years)2017-11-12v41 / 36approvedNo
233amnon high in age 1-year-old human stage compared to under-1-year-old human stage in feces homo sapiens united states of america infant 2017-11-05v41 / 37approvedNo
390amnoncommon feces, homo sapiens, hospital, australia, diarrhea2018-11-04v41 / 38approvedNo
330amnoncommon feces, homo sapiens, infant, kingdom of norway, oslo, age 1 year2018-05-13v41 / 39approvedNo
959amnoncommon feces, homo sapiens, united states of america, ulcerative colitis, child, state of california, ulcerative colitis, los angeles, 6-12 year-old child stage, adolescent stage2022-12-19v41 / 39approvedNo
797amnon high in 3-month-old human stage compared to 1-month-old human stage in feces homo sapiens infant germany formula fed 2021-06-13v31 / 39approvedNo
19amnoncommon in biopsies of children (IBD study) (common homo sapiens, united states of america, rectum, caecum, colon, sigmoid colon, terminal ileum, biopsy, children)2016-11-14v41 / 40approvedNo
714amnoncommon homo sapiens, sigmoid colon, terminal ileum, biopsy, germany2028-05-21v31 / 40approvedNo
825amnoncommon feces, homo sapiens, control, child, china, hangzhou city prefecture, age 6-14 years2021-08-12v31 / 40approvedNo
859amnon high in formula fed compared to breast fed in feces homo sapiens infant state of california hispanic or latin american los angeles district hispanic 6-month-old human stage 2022-01-12v41 / 41approvedNo
876amnon high in age 1 week neonate compared to juvenile organism age 20 months in feces united states of america research facility macaca mulatta state of washington monkey 2022-03-06v41 / 43approvedNo
36amnoncommon feces, homo sapiens, sichuan province2016-12-06v41 / 44approvedNo
1017amnoncommon homo sapiens, adult, canada, disease, calgary, rectal swab, human adult stage, intensive care unit admission, critical illness2023-04-02v41 / 44approvedNo
241amnonhigher in babies from finland compared to estonia ( high in finland compared to estonia in feces homo sapiens infant age < 3 years )2017-11-13v41 / 45approvedNo
273amnoncommon feces, homo sapiens, infant, kingdom of denmark, 1-year-old human stage2018-01-14v41 / 46approvedNo
428amnon high in acute pancreatitis pancreatitis compared to control in feces homo sapiens adult nanchang city prefecture china 2018-12-09v41 / 46approvedNo
591amnoncommon feces, homo sapiens, united states of america, adult, parkinson's disease, human late adulthood stage2020-02-17v41 / 47approvedNo
779amnoncommon feces, homo sapiens, control, adult, guangzhou city prefecture, china2021-04-28v41 / 47approvedNo
651amnoncommon feces, homo sapiens, united states of america, adult, state of alabama, parkinson's disease2020-09-13v41 / 49approvedNo
63amnon high in hard stool constipation compared to normal stool in feces homo sapiens united states of america 2023-11-13v41 / 49pendingNo
441amnonhigher after antibiotic treatment ( high in antibiotic cefoperazone compared to control in feces united states of america research facility mus musculus c57bl/6j mouse )2019-01-06v41 / 50approvedNo
797amnoncommon feces, homo sapiens, child, germany, breast fed, 2-year-old human stage2021-06-13v31 / 50approvedNo
650amnoncommon feces, homo sapiens, united states of america, adult, african american, state of new york2020-09-09v41 / 52approvedNo
797amnon high in infant 12-month-old human stage compared to child 2-year-old human stage in feces homo sapiens germany formula fed 2021-06-13v31 / 52approvedNo
292amnoncommon feces, homo sapiens, adult, ulcerative colitis, china2018-02-05v41 / 53approvedNo
333amnoncommon in stroke patient feces (common feces, homo sapiens, stroke, adult, guangzhou city prefecture, china)2018-05-15v41 / 53approvedNo
286amnonhigher in feces of individuals with kidney stones ( high in nephrolithiasis compared to control in feces homo sapiens adult nanning city prefecture china sixth decade human stage )2018-01-27v41 / 54approvedNo
944amnon high in crohn's disease crohn's disease compared to control in adult biopsy ireland large intestine 2022-11-26v31 / 54approvedNo
292amnoncommon feces, homo sapiens, adult, crohn's disease, china2018-02-05v41 / 55approvedNo
368amnoncommon feces, homo sapiens, united states of america, adult, commonwealth of virginia, systemic lupus erythematosus2018-09-03v41 / 56approvedNo
394amnoncommon feces, homo sapiens, united states of america, adult, state of california, ulcerative colitis2018-11-06v41 / 56approvedNo
591amnoncommon feces, homo sapiens, control, united states of america, adult, human late adulthood stage2020-02-17v41 / 56approvedNo
650amnon high in female compared to male in feces homo sapiens united states of america adult state of new york 2020-09-10v41 / 57approvedNo
651amnoncommon feces, homo sapiens, control, united states of america, adult, state of alabama2020-09-13v41 / 58approvedNo
63amnonhigher in individuals with low physical activity ( high in little physical activity compared to physical activity in feces homo sapiens united states of america )2017-12-04v41 / 59approvedNo
944amnon high in ulcerative colitis ulcerative colitis compared to control in adult biopsy ireland large intestine 2022-11-26v31 / 60approvedNo
333amnoncommon in healthy controls feces (common feces, homo sapiens, control, adult, guangzhou city prefecture, china)2018-05-15v41 / 61approvedNo
619amnoncommon feces, control, united states of america, research facility, mus musculus, mouse, seattle, colonized germ free2020-05-04v31 / 61approvedNo
502amnoncommon feces, homo sapiens, united states of america, adult, schizophrenia2019-03-12v41 / 63approvedNo
671amnon high in age 1 month compared to 3-month-old human stage in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 2020-09-28v41 / 64approvedNo
619amnoncommon feces, united states of america, research facility, cystic fibrosis, mus musculus, mouse, seattle, cftr s489x, colonized germ free2020-05-04v31 / 64approvedNo
242amnoncommon in native-americans (common feces, homo sapiens, united states of america, state of oklahoma, cheyenne, native american, arapaho)2017-11-14v41 / 65approvedNo
448amnoncommon feces, farm, equus caballus, horse, equine grass sickness, disease, united kingdom2019-01-08v41 / 65approvedNo
895amnoncommon feces, homo sapiens, child, french republic, cystic fibrosis, bordeaux, 6-12 year-old child stage2022-04-16v41 / 65approvedNo
398amnon high in crohn's disease compared to control in feces homo sapiens belgium 2018-11-15v41 / 68approvedNo
902amnoncommon feces, united states of america, colitis, antibiotic, equus caballus, horse, adult organism, colitis, antibiotics induced colitis2022-05-02v41 / 68approvedNo
644amnon high in female compared to male in feces homo sapiens united states of america adult hispanic or latin american 2020-08-31v41 / 69approvedNo
797amnon high in formula fed compared to breast fed in feces homo sapiens infant germany 1-month-old human stage 2021-06-13v31 / 69approvedNo
441amnonhigher in mice treated with indomethacin NSAID compared to non-treated controls ( high in non-steroidal anti-inflammatory drug indomethacin compared to control in feces united states of america research facility mus musculus c57bl/6j mouse )2019-01-06v41 / 72approvedNo
448amnon high in equine grass sickness disease compared to control in feces farm equus caballus horse united kingdom 2019-01-08v41 / 72approvedNo
541amnoncommon feces, australia, phascolarctos cinereus, koala, cape otway, eucalyptus viminalis diet, wild2019-08-01v41 / 72approvedNo
859amnon high in 6-month-old human stage compared to 1-month-old human stage in feces homo sapiens infant state of california hispanic or latin american los angeles district hispanic 2022-01-12v41 / 72approvedNo
810amnoncommon in sea turtle feces from sea turtle rescue center (common feces, research facility, mediterranean sea, italy, adriatic sea coastal waters of italy, caretta caretta, loggerhead sea turtle)2021-06-22v31 / 72approvedNo
797amnon high in formula fed compared to breast fed in feces homo sapiens infant germany 3-month-old human stage 2021-06-13v31 / 75approvedNo
438amnonhigher in kindergarten compared to primary and middle school kids ( high in age 3-6 2-5 year-old child stage compared to age 8-12 age 13-14 6-12 year-old child stage 13-year-old human stage 14-year-old human stage in feces homo sapiens china )2018-12-30v41 / 76approvedNo
1081amnoncommon feces, homo sapiens, united states of america, adult, state of new york, melanoma, metastatic malignant neoplasm, cancer, melanoma, human adult stage2024-02-22v41 / 76pendingNo
516amnoncommon feces, homo sapiens, united states of america, adult, state of ohio2019-05-29v41 / 77approvedNo
541amnoncommon feces, australia, phascolarctos cinereus, koala, cape otway, eucalyptus obliqua diet, wild2019-08-01v41 / 77approvedNo
644amnonlower in individuals born in latin america compared to indivuals born in usa ( high in usa born compared to non usa born in feces homo sapiens united states of america adult hispanic or latin american )2020-08-31v41 / 77approvedNo
589amnoncommon feces, united states of america, research facility, mus musculus, c57bl/6, state of georgia, mouse, jackson laboratories, high fat diet + inulin2020-02-10v41 / 78approvedNo
974amnoncommon in feces of marmosets reintroduced to the wild (common feces, brazil, monkey, captive, anal swab, callithrix <genus>, marmosets)2022-12-24v41 / 78approvedNo
434amnonhigher in antibiotics treated rats compared to controls ( high in antibiotic ampicillin neomycin compared to control in feces research facility caecum rattus norvegicus sprague dawley switzerland rat )2018-12-20v41 / 80approvedNo
292amnoncommon feces, homo sapiens, control, adult, china2018-02-05v41 / 81approvedNo
344amnoncommon in feces of heterosexuals (common feces, homo sapiens, united states of america, state of colorado, denver, heterosexual, msw)2018-05-31v41 / 82approvedNo
590amnoncommon farm, intestine, age 3-5 weeks, china, hainan autonomous prefecture, trachemys scripta elegans, red-eared slider turtle, turtle farm2020-02-10v41 / 83approvedNo
959amnoncommon feces, homo sapiens, control, united states of america, child, state of california, los angeles, 6-12 year-old child stage, adolescent stage2022-12-19v41 / 83approvedNo
249amnoncommon feces, homo sapiens, united states of america2017-11-22v41 / 86approvedNo
841amnoncommon feces, homo sapiens, united states of america, adult, state of texas, human adult stage2021-11-08v41 / 86approvedNo
62amnon high in united states of america compared to egypt in feces homo sapiens child obsolete_juvenile stage 2017-02-13v41 / 88approvedNo
582amnoncommon united states of america, rectum, perianal skin, santa catalina island, urocyon littoralis, urocyon littoralis catalinae, santa catalina island fox, wild2020-01-22v41 / 88approvedNo
884amnoncommon feces, homo sapiens, united states of america, adult, state of california, human adult stage2022-03-24v41 / 88approvedNo
958amnoncommon feces, homo sapiens, united states of america, adult, state of texas, mexico, mexican american2022-12-19v41 / 91approvedNo
601amnoncommon feces, homo sapiens, control, adult, china2020-03-30v41 / 93approvedNo
853amnoncommon research facility, caecum, oryctolagus cuniculus, french republic, cecal content, rabbit, juvenile, age 5 weeks, hyplus rabbit, exclusive breastmilk diet2021-12-20v31 / 96approvedNo
1024amnoncommon in children with neurological impairment and long-term enteral nutrition (common feces, homo sapiens, child, italy, epileptic encephalopathy, cerebral palsy, body dysmorphic disorder, milan, 6-12 year-old child stage, adolescent stage, enteral nutrition diet)2023-07-21v31 / 100pendingNo
1017amnoncommon homo sapiens, control, adult, canada, calgary, rectal swab, human adult stage2023-04-02v41 / 101approvedNo
538amnon high in taconic farms compared to jackson laboratories in research facility ileum mus musculus c57bl/6 terminal ileum canada mouse age 8 weeks 2019-07-29v41 / 104approvedNo
1067amnoncommon feces, united states of america, research facility, felis catus, cat, state of missouri, age 25-35 weeks2023-12-09v41 / 106pendingNo
215amnoncommon feces, homo sapiens, united states of america2017-10-23v41 / 107approvedNo
213amnonlower in patients with bacterial vaginosis compared to healthy controls ( high in control compared to bacterial vaginosis in homo sapiens vagina south africa )2017-10-31v41 / 107approvedNo
538amnon high in taconic farms compared to jackson laboratories in research facility colon right colon mus musculus c57bl/6 canada mouse age 8 weeks 2019-07-29v41 / 108approvedNo
438amnoncommon feces, homo sapiens, child, jiangsu province, age 3-6, china, 2-5 year-old child stage2018-12-30v41 / 109approvedNo
276amnoncommon feces, homo sapiens, united states of america, city, adult, state of oklahoma2018-01-22v41 / 110approvedNo
380amnon high in gangcha region compared to gannan tibetan autonomous prefecture in feces homo sapiens adult tibetan plateau tibet autonomous region 2018-10-03v41 / 114approvedNo
239amnoncommon feces, homo sapiens, united states of america2017-11-08v41 / 117approvedNo
409amnoncommon homo sapiens, united states of america, left colon, biopsy site, adult, biopsy2018-11-22v41 / 118approvedNo
410amnonlower in feces compared to rectal biopsies in children with treatment naive uc ( high in rectum biopsy site biopsy compared to feces in homo sapiens united states of america child ulcerative colitis )2018-11-22v41 / 118approvedNo
294amnoncommon feces, homo sapiens, adult, kingdom of spain, irritable bowel syndrome2018-02-09v41 / 120approvedNo
538amnoncommon feces, research facility, mus musculus, c57bl/6, canada, mouse, taconic farms, age 8 weeks2019-07-30v41 / 120approvedNo
438amnoncommon feces, homo sapiens, adult, jiangsu province, age >94, china, ninth decade human stage, tenth decade human stage2018-12-30v41 / 121approvedNo
538amnoncommon research facility, colon, right colon, mus musculus, c57bl/6, canada, mouse, taconic farms, age 8 weeks2019-07-30v41 / 130approvedNo
538amnoncommon research facility, ileum, mus musculus, c57bl/6, terminal ileum, canada, mouse, taconic farms, age 8 weeks2019-07-30v41 / 132approvedNo
438amnoncommon feces, homo sapiens, jiangsu province, age 13-14, china, 13-year-old human stage, 14-year-old human stage2018-12-30v41 / 134approvedNo
644amnonlower in individuals born in mexico compared to cuba ( high in cuba compared to mexico in feces homo sapiens united states of america adult hispanic or latin american )2020-08-31v41 / 134approvedNo
400amnonhigher in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in hmong china compared to myanmar karen in feces homo sapiens thailand rural community )2018-11-18v41 / 135approvedNo
538amnon high in taconic farms compared to jackson laboratories in feces research facility mus musculus c57bl/6 canada mouse age 8 weeks 2019-07-29v41 / 135approvedNo
10amnoncommon feces, homo sapiens, toronto2016-10-27v41 / 138approvedNo
132amnoncommon feces, homo sapiens, united states of america2017-04-16v41 / 145approvedNo
241amnonlower in babies from russia compared to finland ( high in finland compared to russia in feces homo sapiens infant age < 3 years )2017-11-13v41 / 148approvedNo
74amnonHigher in animal product diet compared to plant diet ( high in diet animal product diet compared to plant diet in feces homo sapiens united states of america )2017-02-27v41 / 149approvedNo
589amnoncommon feces, united states of america, research facility, mus musculus, low fat diet, c57bl/6, state of georgia, mouse, mouse chow, jackson laboratories2020-02-10v41 / 151approvedNo
866amnoncommon feces, united states of america, research facility, mus musculus, c57bl/6, stress, state of illinois, mouse, restraint stress2022-02-08v41 / 152approvedNo
1070amnoncommon feces, homo sapiens, control, adult, china, human adult stage2023-12-14v31 / 156pendingNo
981amnoncommon uganda, chimpanzee, primates, ngamba island, pan troglodytes schweinfurthii, rectal swab, wild2022-12-25v31 / 157approvedNo
290amnoncommon feces, homo sapiens, city, adult, china2018-02-01v41 / 162approvedNo
297amnoncommon feces, homo sapiens, united states of america, child, atlanta, obsolete_juvenile stage, age<17 years, immature stage, adolescent stage2018-02-12v41 / 162approvedNo
1067amnon high in feces compared to oropharynx in united states of america research facility felis catus cat state of missouri age 25-35 weeks 2023-12-09v41 / 163pendingNo
1070amnoncommon feces, homo sapiens, adult, cholangiocarcinoma, china, human adult stage2023-12-14v31 / 166pendingNo
276amnon high in united states of america city state of oklahoma compared to peru small village tunapuco rural community in feces homo sapiens adult 2018-01-22v41 / 168approvedNo
241amnonlower in babies from russia compared to estonia ( high in estonia compared to russia in feces homo sapiens infant age < 3 years )2017-11-13v41 / 169approvedNo
521amnoncommon in pre-weaned pigs (common feces, farm, sus scrofa, jiangxi province, pig, suckling, preweaned, age 2-4 weeks, china)2019-07-02v31 / 169approvedNo
123amnon high in diet high fat diet compared to normal diet mouse chow in feces united states of america research facility mus musculus c57bl/6j mouse 2017-04-13v41 / 170approvedNo
424amnonfarm dependent in feces of pigs with same genetic background ( high in farm 1 compared to farm 2 in feces farm sus scrofa jinhua city prefecture pig jinhua pig china )2018-12-06v41 / 171approvedNo
589amnoncommon in high fat diet supplemented with cellulose in mice feces (common feces, united states of america, research facility, mus musculus, high fat diet, c57bl/6, state of georgia, mouse, jackson laboratories)2020-02-10v41 / 172approvedNo
529amnoncommon in patients that underwent low anterior resection (common feces, homo sapiens, adult, taipei city, taiwan, low anterior resection)2019-07-18v31 / 172approvedNo
960amnon high in infant 18-month-old human stage compared to female adult in feces homo sapiens nigeria edo state 2022-12-20v41 / 178approvedNo
179amnoncommon united states of america, research facility, oral cavity, mus musculus, balb/c, mouse, mouth2017-08-13v41 / 183approvedNo
399amnoncommon feces, united states of america, research facility, rattus norvegicus, rat2018-11-16v41 / 184approvedNo
73amnonhigh in children with Crohn's disease compared to healthy adult controls ( high in child obsolete_juvenile stage crohn's disease compared to control adult in feces homo sapiens glasgow )2017-02-26v41 / 185approvedNo
197amnon high in india compared to finland in feces homo sapiens juvenile organism obsolete_juvenile stage 13-year-old human stage 2017-09-12v41 / 189approvedNo
389amnon high in age 1-3 weeks compared to age 4 weeks in united states of america farm tonsil sus scrofa state of michigan pig 2018-11-04v41 / 189approvedNo
866amnoncommon feces, control, united states of america, research facility, mus musculus, c57bl/6, state of illinois, mouse2022-02-08v41 / 193approvedNo
1070amnon high in cholangiocarcinoma compared to control in feces homo sapiens adult china human adult stage 2023-12-14v31 / 194pendingNo
312amnoncommon feces, homo sapiens, adult, french republic, spondyloarthritis, spondylitis2018-04-09v41 / 197approvedNo
1024amnonhigher in children with neurological impairment and long-term enteral nutrition ( high in epileptic encephalopathy cerebral palsy body dysmorphic disorder enteral nutrition diet compared to control in feces homo sapiens child italy milan 6-12 year-old child stage adolescent stage )2023-07-21v31 / 197pendingNo
120amnoncommon feces, homo sapiens, brazil2017-04-12v41 / 208approvedNo
669amnon high in 12-month-old human stage compared to 2-month-old human stage in feces homo sapiens infant sweden 2020-09-26v41 / 212approvedNo
520amnonhigher in gastric cancer compared to paired normal tissue ( high in gastric carcinoma stomach neoplasm compared to control in homo sapiens stomach adult zhejiang province china )2019-06-26v31 / 214approvedNo
455amnoncommon feces, homo sapiens, adult, canada, atherosclerosis2019-01-10v41 / 216approvedNo
671amnon high in state of california compared to state of oregon in feces united states of america research facility macaca mulatta age 1 month monkey captive rhesus macaque 2020-09-27v41 / 217approvedNo
290amnoncommon feces, homo sapiens, adult, small village, rural community, china2018-02-01v41 / 218approvedNo
566amnoncommon feces, homo sapiens, adult, china2019-11-24v41 / 221approvedNo
902amnon high in salmonella gastroenteritis salmonellosis compared to control in feces united states of america equus caballus horse adult organism 2022-05-02v41 / 226approvedNo
873amnon high in botswana compared to tanzania in feces homo sapiens adult africa rural community human adult stage 2022-03-03v11 / 226approvedNo
310amnoncommon feces, homo sapiens, female, rectum, adult, poland2018-04-07v41 / 227approvedNo
873amnon high in united states of america commonwealth of pennsylvania urban community compared to tanzania africa rural community botswana in feces homo sapiens adult human adult stage 2022-03-03v11 / 227approvedNo
25amnon high in antibiotic compared to control in research facility caecum oryctolagus cuniculus rex rabbit sichuan province 2016-12-01v41 / 231approvedNo
53amnon high in lima shantytown compared to el salado small village in feces homo sapiens city 2017-01-21v41 / 236approvedNo
286amnoncommon in feces of individuals with kidney stones (common feces, homo sapiens, adult, nanning city prefecture, nephrolithiasis, china, sixth decade human stage)2018-01-27v41 / 239approvedNo
960amnon high in 9-month-old human stage compared to 1-month-old human stage in feces homo sapiens infant nigeria edo state 2022-12-20v41 / 244approvedNo
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in feces homo sapiens adult bangladesh )2017-04-13v41 / 263approvedNo
286amnoncommon in feces of individuals without kidney stones (common feces, homo sapiens, control, adult, nanning city prefecture, china, sixth decade human stage)2018-01-27v41 / 281approvedNo
477amnon high in united states of america compared to nepal himalayas rural community in feces homo sapiens adult 2019-01-28v41 / 295approvedNo
683amnonlower in antibiotic treatment (combined 3 antibiotics) compared to pre-treatment ( high in control compared to antibiotic vancomycin metronidazole neomycin in feces homo sapiens united states of america adult state of california )2028-03-04v41 / 301approvedNo
927amnoncommon feces, italy, podarcis siculus, lizard, punta licosa2022-08-15v31 / 305approvedNo
299amnon high in mouth neoplasm cancer compared to control in homo sapiens saliva adult china 2018-02-27v41 / 319approvedNo
400amnonlower in people from thailand compared to 2nd generation immigrants to usa ( high in united states of america compared to thailand rural community in feces homo sapiens )2018-11-18v41 / 343approvedNo
521amnonhigher in pre-weaned pigs compared to weaned older timepoints ( high in suckling preweaned age 2-4 weeks compared to weaned corn and soybean diet age 4-7 weeks in feces farm sus scrofa jiangxi province pig china )2019-07-02v31 / 347approvedNo
537amnonlower in feces of deer mice grown in captivity compared to wild caught ( high in wild compared to research facility captive in feces canada province of ontario algonquin provincial park peromyscus maniculatus deer mice age 3-5 weeks )2019-07-28v31 / 358approvedNo
891amnon high in 1-year-old human stage compared to under-1-year-old human stage in feces homo sapiens infant bangladesh dhaka infant stage urban slum 2022-04-03v41 / 363approvedNo
902amnon high in colitis antibiotic colitis antibiotics induced colitis compared to control in feces united states of america equus caballus horse adult organism 2022-05-02v41 / 364approvedNo
62amnoncommon feces, homo sapiens, united states of america, child, obsolete_juvenile stage2017-02-13v41 / 373approvedNo
63amnon high in female compared to male in feces homo sapiens united states of america 2017-12-04v41 / 384approvedNo
847amnon high in eleventh decade human stage centenarian human stage compared to ninth decade human stage in feces japan 80 year-old and over human stage 2021-12-01v11 / 387approvedNo
582amnon high in rectum perianal skin compared to external acoustic meatus ear canal in united states of america santa catalina island urocyon littoralis urocyon littoralis catalinae santa catalina island fox wild 2020-01-22v41 / 400approvedNo
666amnoncommon feces, italy, rat, rattus rattus2020-09-25v31 / 406approvedNo
371amnonlower in amerindians compared to western visitors ( high in united states of america city compared to venezuela amerindian hunter gatherer in feces homo sapiens )2018-09-06v41 / 417approvedNo
62amnoncommon feces, homo sapiens, child, egypt, obsolete_juvenile stage2017-02-13v41 / 422approvedNo
438amnonhigher in centenarians compared to adults ( high in age >94 ninth decade human stage tenth decade human stage compared to 65-79 year-old human stage fourth decade human stage fifth decade human stage in feces homo sapiens china )2018-12-30v41 / 474approvedNo
650amnon high in caucasian european compared to asian in feces homo sapiens united states of america adult state of new york 2020-09-12v41 / 475approvedNo
927amnon high in punta licosa compared to licosa island in feces italy podarcis siculus lizard 2022-08-15v31 / 509approvedNo
657amnoncommon research facility, rumen, ovis aries, qinghai province, rumen liquid, age < 1 year, sheep, lamb, china2020-09-13v41 / 517approvedNo
273amnon high in age 1-year-old human stage compared to 1-month-old human stage in feces homo sapiens infant kingdom of denmark 2018-01-14v41 / 557approvedNo
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in age 1-year-old human stage compared to under-1-year-old human stage in feces homo sapiens infant finland )2017-11-12v41 / 567approvedNo
372amnon high in mouse chow compared to high fat diet in feces united states of america research facility mus musculus mouse 2018-09-07v41 / 579approvedNo
729amnon high in zoological garden captive europe compared to cameroon wild in feces gorilla gorilla monkey 2021-01-05v31 / 656approvedNo
232amnonlower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control compared to ulcer wound in homo sapiens skin foot australia diabetes mellitus )2017-11-05v41 / 836approvedNo
252amnoncommon in river rock biofilm (common river, rock, biofilm, kingdom of spain, epilithic, biofilm)2017-11-22v41 / 1081approvedNo
916amnon high in farm2 compared to farm1 in research facility caecum oryctolagus cuniculus kingdom of spain age 2 months rabbit 2022-07-04v41 / 1191approvedNo

Problems / suggestions? Please visit the dbBact forum